kedro.contrib.io.bioinformatics.BioSequenceLocalDataSet

class kedro.contrib.io.bioinformatics.BioSequenceLocalDataSet(filepath, load_args=None, save_args=None)[source]

Bases: kedro.contrib.io.core.DefaultArgumentsMixIn, kedro.io.core.AbstractDataSet

BioSequenceLocalDataSet loads and saves data to a sequence file.

Example:

raw_sequence_list = [
    '>gi|2765658|emb|Z78533.1|CIZ78533'
    'C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA'
    'CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAA'
    'CGATCGAGTGAATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGT'
    'GACCCTGATTTGTTGTTGGGCCGCCTCGGGAGCGTCCATGGCGGGTTTGAACCTCTAGCC'
    'CGGCGCAGTTTGGGCGCCAAGCCATATGAAAGCATCACCGGCGAATGGCATTGTCTTCCC'
    'CAAAACCCGGAGCGGCGGCGTGCTGTCGCGTGCCCAATGAATTTTGATGACTCTCGCAAA'
    'CGGGAATCTTGGCTCTTTGCATCGGATGGAAGGACGCAGCGAAATGCGATAAGTGGTGTG'
    'AATTGCAAGATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCGCCCGAGGCCATCA'
    'GGCTAAGGGCACGCCTGCTTGGGCGTCGCGCTTCGTCTCTCTCCTGCCAATGCTTGCCCG'
    'GCATACAGCCAGGCCGGCGTGGTGCGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCG'
    'GCGGGTCCAAGAGCTGGTGTTTTGATGGCCCGGAACCCGGCAAGAGGTGGACGGATGCTG'
    'GCAGCAGCTGCCGTGCGAATCCCCCATGTTGTCGTGCTTGTCGGACAGGCAGGAGAACCC'
    'TTCCGAACCCCAATGGAGGGCGGTTGACCGCCATTCGGATGTGACCCCAGGTCAGGCGGG'
    'GGCACCCGCTGAGTTTACGC']
data_set = BioSequenceLocalDataSet(filepath="ls_orchid.fasta",
                                   load_args={"format": "fasta"},
                                   save_args={"format": "fasta"})
data_set.save(raw_sequence_list)
sequence_list = data_set.load()
assert raw_sequence_list.equals(sequence_list)

Attributes

BioSequenceLocalDataSet.DEFAULT_LOAD_ARGS
BioSequenceLocalDataSet.DEFAULT_SAVE_ARGS

Methods

BioSequenceLocalDataSet.__init__(filepath[, …]) Creates a new instance of BioSequenceLocalDataSet pointing to a concrete filepath.
BioSequenceLocalDataSet.exists() Checks whether a data set’s output already exists by calling the provided _exists() method.
BioSequenceLocalDataSet.from_config(name, config) Create a data set instance using the configuration provided.
BioSequenceLocalDataSet.get_last_load_version() Versioned datasets should override this property to return last loaded version
BioSequenceLocalDataSet.get_last_save_version() Versioned datasets should override this property to return last saved version.
BioSequenceLocalDataSet.load() Loads data by delegation to the provided load method.
BioSequenceLocalDataSet.release() Release any cached data.
BioSequenceLocalDataSet.save(data) Saves data by delegation to the provided save method.
DEFAULT_LOAD_ARGS = {}
DEFAULT_SAVE_ARGS = {}
__init__(filepath, load_args=None, save_args=None)[source]

Creates a new instance of BioSequenceLocalDataSet pointing to a concrete filepath.

Parameters:
  • filepath (str) – path to sequence file
  • load_args (Optional[Dict[str, Any]]) – Options for loading sequence files. Here you can find all supported file formats: https://biopython.org/wiki/SeqIO
  • save_args (Optional[Dict[str, Any]]) – args supported by Biopython are ‘handle’ and ‘format’. Handle by default is equal to filepath.
Return type:

None

exists()

Checks whether a data set’s output already exists by calling the provided _exists() method.

Return type:bool
Returns:Flag indicating whether the output already exists.
Raises:DataSetError – when underlying exists method raises error.
classmethod from_config(name, config, load_version=None, save_version=None)

Create a data set instance using the configuration provided.

Parameters:
  • name (str) – Data set name.
  • config (Dict[str, Any]) – Data set config dictionary.
  • load_version (Optional[str]) – Version string to be used for load operation if the data set is versioned. Has no effect on the data set if versioning was not enabled.
  • save_version (Optional[str]) – Version string to be used for save operation if the data set is versioned. Has no effect on the data set if versioning was not enabled.
Return type:

AbstractDataSet

Returns:

An instance of an AbstractDataSet subclass.

Raises:

DataSetError – When the function fails to create the data set from its config.

get_last_load_version()

Versioned datasets should override this property to return last loaded version

Return type:Optional[str]
get_last_save_version()

Versioned datasets should override this property to return last saved version.

Return type:Optional[str]
load()

Loads data by delegation to the provided load method.

Return type:Any
Returns:Data returned by the provided load method.
Raises:DataSetError – When underlying load method raises error.
release()

Release any cached data.

Raises:DataSetError – when underlying exists method raises error.
Return type:None
save(data)

Saves data by delegation to the provided save method.

Parameters:data (Any) – the value to be saved by provided save method.
Raises:DataSetError – when underlying save method raises error.
Return type:None